RNF213, a new nuclear marker for acanthomorph phylogeny

Blaise Li

Notothenioids represent an adaptive radiation of teleost fishes in the frigid and ice-laden waters of the Southern Ocean surrounding Antarctica. Phylogenetic hypotheses for this clade have resulted primarily from analyses of mtDNA gene sequences, and studies utilizing nuclear gene DNA sequence data have focused on particular sub-clades of notothenioid fishes.

Acanthomorpha (spiny-rayed fishes) is a clade of teleosts that includes more than 15 000 extant species. Their deep phylogenetic intrarelationships, first reconstructed using morphological characters, have been extensively revised with molecular data. Moreover, the deep branches of the acanthomorph tree are still largely unresolved, with strong disagreement between studies. Here, we review the historical propositions for acanthomorph deep intrarelationships and attempt to resolve their earliest branching patterns using a new morphological data matrix compiling and revising characters from previous studies. The taxon sampling we use constitutes a first attempt to test all previous hypotheses (molecular and morphological alike) with morphological data only. Our sampling also includes Late Cretaceous fossil taxa, which yield new character state combinations that are absent in extant taxa. Analysis of the complete morphological data matrix yields a new topology that shows remarkable congruence with the well-supported molecular results. Lampridiformes (oarfishes and allies) are the sister to all other acanthomorphs. Gadiformes (cods and allies) and Zeiformes (dories) form a clade with Percopsiformes (trout-perches) and the enigmatic Polymixia (beardfish) and Stylephorus (tube-eye). Ophidiiformes (cusk-eels and allies) and Batrachoidiformes (toadfishes) are nested within Percomorpha, the clade that includes most of modern acanthomorph diversity. These results provide morphological synapomorphies and independent corroboration of clades previously only recovered from molecular data, thereby suggesting the emergence of a congruent picture of acanthomorph deep intrarelationships. Fossil taxa play a critical role in achieving this congruence, since a very different topology is found when they are excluded from the analysis.

Molecular Phylogenetics and Evolution 50 (2009) 345–363 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev RNF213, a new nuclear marker for acanthomorph phylogeny Blaise Li a, Agnès Dettaï a, Corinne Cruaud b, Arnaud Couloux b, Martine Desoutter-Meniger a, Guillaume Lecointre a,* a Équipe ‘Phylogénie’, UMR 7138 ‘Systématique, Adaptation, Évolution’, Département Systématique et Évolution, Muséum National d’Histoire Naturelle, 57, rue Cuvier, CP26, 75231 Paris cedex 05, France b Genoscope, Centre National de Séquençage, 2, rue Gaston Crémieux, CP5706, 91057 Évry cedex, France a r t i c l e i n f o Article history: Received 10 July 2008 Revised 11 November 2008 Accepted 15 November 2008 Available online 27 November 2008 Keywords: Acanthomorpha RNF213 Nuclear marker Phylogeny Reliability a b s t r a c t We show that RNF213 is a nuclear gene suitable for investigating large scale acanthomorph teleosteans interrelationships. The gene recovers many clades already found by several independent studies of acanthomorph molecular phylogenetics and considered as reliable. Moreover, we performed phylogenetic analyses of three other independent nuclear markers, first separately and then of all possible combinations (Dettaï, A., Lecointre, G., 2004. In search of nothothenioid (Teleostei) relatives. Antarct. Sci. 16 (1), 71–85. URL http://dx.doi.org/10.1017/S0954102004) of the four genes. This was coupled with an assessment of the reliability of clades using the repetition index of Li and Lecointre (Li, B., Lecointre, G., 2008. Formalizing reliability in the taxonomic congruence approach. Article accepted by Zoologica Scripta. URL http://dx.doi.org/10.1111/j.1463-6409.2008.00361.x). This index was improved here to handle the incomplete taxonomic overlap among datasets. The results lead to the identification of new reliable clades within the ‘acanthomorph bush’. Within a clade containing the Atherinomorpha, the Mugiloidei, the Plesiopidae, the Blennioidei, the Gobiesocoidei, the Cichlidae and the Pomacentridae, the Plesiopidae is the sister-group of the Mugiloidei. The Apogonidae are closely related to the Gobioidei. A clade named ‘H’ grouping a number of families close to stromateids and scombrids (Stromateidae, Scombridae, Trichiuridae, Chiasmodontidae, Nomeidae, Bramidae, Centrolophidae) is related to another clade named ‘E’ (Aulostomidae, Macrorhamphosidae, Dactylopteridae). The Sciaenidae is closely related to the Haemulidae. Within clade ‘X’ (Dettaï, A., Lecointre, G., 2004. In search of nothothenioid (Teleostei) relatives. Antarct. Sci. 16 (1), 71–85. URL http://dx.doi.org/10.1017/S0954102004), the Cottoidei, the Zoarcoidei, the Gasterosteidae, the Triglidae, the Scorpaenidae, the Sebastidae, the Synanceiidae, and the Congiopodidae form a clade. Within clade ‘L’ (Chen, W.-J., Bonillo, C., Lecointre, G., 2003. Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa. Mol. Phylogenet. Evol. 26, 262–288; Dettaï, A., Lecointre, G., 2004. In search of nothothenioid (Teleostei) relatives. Antarct. Sci. 16 (1), 71–85. URL http://dx.doi.org/10.1017/ S0954102004) grouping carangoids with flatfishes and other families (Centropomidae, Menidae, Sphyraenidae, Polynemidae, Echeneidae, Toxotidae, Xiphiidae), carangids are the stem-group of echeneids and coryphaenids, and sphyraenids are the sister-group to the Carangoidei. The Howellidae, the Epigonidae and the Lateolabracidae are closely related. We propose names for most of the clades repeatedly found in acanthomorph phylogenetic studies of various teams of the past decade. Ó 2008 Elsevier Inc. All rights reserved. 1. Introduction Acanthomorphs are a large group of more than 16,000 teleostean fish species. This monophyletic group is composed of some well supported clades but also of some poorly defined large assemblages like percomorphs, perciforms, scorpaeniforms. Most of these have been suspected not to be monophyletic for a long time (Stiassny et al., 2004). Morphology and comparative anatomy are * Corresponding author. Fax: +33 1 40 79 38 44. E-mail addresses: blaise.li@normalesup.org (B. Li), adettai@mnhn.fr (A. Dettaï), lecointr@mnhn.fr (G. Lecointre). 1055-7903/$ - see front matter Ó 2008 Elsevier Inc. All rights reserved. doi:10.1016/j.ympev.2008.11.013 difficult to use for phylogenetic purposes at such a large scale (see Stiassny and Moore, 1992, 1993). Even after the efforts to clarify acanthomorph interrelationships, synthesized by Johnson and Patterson (1993), many of the large clades retained later appeared strongly contradicted by molecular phylogenies (Chen et al., 2000, 2003, 2007; Dettaï and Lecointre, 2004, 2005, 2008, submitted for publication; Miya et al., 2001, 2003, 2005; Mabuchi et al., 2007; Kawahara et al., 2008; Smith and Wheeler, 2004, 2006; Smith and Craig, 2007). Paracanthopterygii, Acanthopterygii, Euacanthopterygii and Smegmamorpha, for instance, are all in this case. These large divisions had to be broken up because new contradicting groups were supported from independent molecular 346 B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 studies. Percoids also are widely distributed among acanthomorphs, so at least the traditionally defined percomorphs, perciforms, scorpaeniforms and percoids can now be considered polyphyletic (see Dettaï and Lecointre, 2005, 2008, 2007). Moreover, new groups emerged as a result of the analyses in a single matrix of a significant number of taxonomic components, often compared directly for the first time. The picture of large scale acanthomorph fish interrelationships changes rapidly, just like the mammalian tree changed as soon as enough genes were sequenced for all eutherian orders. However the acanthomorph revolution is far from being over. Large scale relationships are still poorly known: areas of irresolution remain and all 311 families (Nelson, 2006) have not yet been sampled. In spite of the recent spectacular advances, ‘the bush at the top’ (Nelson, 1989) persists. More acanthomorph families must be sampled, and in parallel, a higher number of phylogenetically efficient nuclear markers must be available (Li et al., 2007, 2008). Reliability of phylogenetic findings is generally considered to be reached when several teams have found the same results independently from independent markers. This can be applied to the work of a single research team, by performing separate phylogenetic analyses of different independent molecular markers and checking for clade repetition across trees. Of course, it is necessary to base the study not only on mitochondrial markers, but also on carefully chosen, functionally and positionally independent nuclear markers. This comparative methodology was applied on acanthomorph by Chen et al. (2003), Dettaï and Lecointre (2004, 2005) and more recently by Miya et al. (2007) and Dettaï and Lecointre (submitted for publication). Studies using the partial rhodopsin retrogene (Chen et al., 2003), MLL (Dettaï and Lecointre, 2004, 2005) and IRBP (Dettaï and Lecointre, 2008) showed that these nuclear markers bear information relevant to the phylogeny of acanthomorphs. Other markers must be used more cautiously on this group and at this scale, like for instance 28S rDNA sequences (Chen et al., 2003) and TMO4C4 gene sequences (Smith and Wheeler, 2004). Therefore, there is still a need for additional, high phylogenetic quality markers. The availability of several teleost genomes opens new opportunities for the research of new markers, as also demonstrated by the study of Li et al., 2007, 2008. In the present study, we used the Ensembl Biomart mining tool and selected a few candidates markers. A promising locus, RNF213, was amplified for a representative sampling of teleost acanthomorphs, and compared to other large nuclear and mitochondrial datasets. Additionally, we performed combined and separate phylogenetic analyses with retro-rhodopsin, MLL and IRBP, and assessed the reliability of clades using the repetition index of Li and Lecointre (2008). 2. Materials and methods 2.1. Selection of the molecular markers In the case of the interfamilial relationships of Acanthomorpha, the addition of new nuclear markers appears to be still necessary: the changes between the topologies and reliabilities between Chen et al. (2003) and Dettaï and Lecointre (2004, 2005, 2008) show that the inclusion of new markers increases the number of repeated clades even if the sampling is similar (Dettaï and Lecointre, 2005, 2008, submitted for publication). In previous studies, we used protein-coding nuclear genes as well as mitochondrial (12S and 16S, Chen et al., 2003; Dettaï and Lecointre, 2004, 2005) and nuclear (28S, Chen et al., 2003) rDNA sequences. Alignment difficulties and low phylogenetic content of these rDNA genes with respect to the acanthomorph issue led us to abandon these markers and focus on carefully chosen nuclear protein-coding genes. The Biomart mining tool of the Ensembl Portal (Hubbard et al., 2005) release 40 was used to get a list of protein-coding genes shared by Tetraodon nigroviridis, Takifugu rubripes, and Danio rerio, using T. nigroviridis as a query. Genes having unique best hits were retained, and checked for divergence and exon length through the Ensembl Portal on all the available teleost genomes. The sequence coding for RNF213 was again blasted (Altschul et al., 1997) on all available teleost genomes to check that it was a single copy marker in all. Last, it was blasted in the CoreNucleotide database of Genbank and all available sequences for acanthomorph species were recovered and used for primer design after alignment with Bioedit (Hall, 2001). The primers are listed in Table 1. The previously published datasets for the retro-rhodopsin (simply noted ‘Rhodopsin’ afterwards), MLL and IRBP genes were completed with additional taxa (Table 2). To these, we added sequence data from the gene RNF213. 2.2. PCR and sequencing DNA was extracted mostly from muscle samples stored in 70% ethanol, following the protocol of Winnepenninckx et al. (1993). Table 1 Primers used in this study. Primer Sequence ð50 ! 30 Þ Forward/reverse Source Rh193 Rh667r Rh1039r Rh1073r MLL U1477 MLL U1499 MLL U1570 MLL U1590 MLL L2080 MLL 2105 MLL L2158 IRBP U104 IRBP U110 IRBP L936 IRBP L953 IRBP L1338 C17 F3111 C17 F3128 C17 F3150 C17 R4036 C17 R4096 C17 R4111 CNTATGAATAYCCTCAGTACTACC AYGAGCACTGCATGCCCT TGCTTGTTCATGCAGATGTAGA CCRCAGCACARCGTGGTGATCATG AGYCCAGCRGTCATCAAACC GTCAATCAGCAGTTCCAGC CCCYCAAAAKATCARTGCCAC CRGGRGTGATNGACACCAGC GTGAACTCMAYCAGTCCTCC ACCYTGCGTTGGGARGTGG ARAGTAGTGGGATCYAGRTACAT ATAGTYNTGGACAANTACTGCTC TGGACAAYTACTGCTCRCCAGA CACGGAGGYTGAYNATCTTGAT CNGGAAYYTGARCACGGAGG GTGRAAGGAGAYTTTGATCAGCTC GCTGACTGGATTYAAAACCTT CCTTTGTGGTGGAYTTYATGAT WCTGATGGCNAARGACTTTGC GGRATRGANCCNAGCTTTTCAT CCANACCAGAGGGATCATRCT AACTGTCCAAARTCCCACAC Forward Reverse Reverse Reverse Forward Forward Forward Forward Reverse Reverse Reverse Forward Forward Reverse Reverse Reverse Forward Forward Forward Reverse Reverse Reverse Chen et al. (2003) Chen et al. (2003) Chen et al. (2003) Chen et al. (2003) Dettaı̈ and Lecointre Dettaı̈ and Lecointre This study This study This study This study Dettaı̈ and Lecointre Dettaı̈ and Lecointre Dettaı̈ and Lecointre Dettaı̈ and Lecointre Dettaı̈ and Lecointre Dettaı̈ and Lecointre This study This study This study This study This study This study (2005) (2005) (2005) (2008) (2008) (2008) (2008) (2008) B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 347 Table 2 Sequences used in this study. Taxonomy follows Nelson, 2006, except for families, that are those present in Fishbase (Froese and Pauly, 2006). Sequences in boldface font are new sequences. Order/suborder Family Genus/species Rhosopsin MLL IRBP RNF213 Alepocephalidae Alepocephalus antipodianus (Parrot, 1948) EU637933 — — — Gonostomatidae Gonostoma bathyphilum (Valliant, 1884) AY141256 — — — Bathypterois dubius Vallian, 1888 AY141257 AY362219 DQ168042 — Myctophidae Electrona antarctica (Günther, 1878) AY141258 AY36220 — — Lampridae Trachipteridae Regalecidae Lampris immaculatus Gilchrist, 1904 Trachipterus arcticus (Brünnich, 1788) Regalecus glesene Ascanius, 1772 AY141259 — AY368328 — — AY362266 DQ168077 EU638158 DQ168109 — — EU638252 Polymixiidae Polymixia nibilis Lowe, 1838 AY368320 AY362208 DQ168104 — Apherdoderidae Aphredoderus sayanus (Gilliams, 1824) — — DQ168038 — Muraenolepididae Macrouridae Macrouridae Moridae Merlucciidae Phycidae Lotidae Lotidae Lotidae Lotidae Gadidae Gadidae Muraenolepsis marmorata Günther, 1880 Coryphaeniides rupestris Gunnerus, 1765 Trachyrincus murrayi Günther, 1887 Mora moro (Risso, 1810) Merluccius merluccis (L., 1758) Phcis physics (L., 1766) Enchelyopus cimbrius (L., 1766)4 Gaidropsarus (Hector, 1874) Gaidropsarus sp. Gaidropsarus vulgaris (Cloquet, 1824) Gadus morhua L., 1758 Merlangius merlangus (L., 1758) — AY368319 AY368318 AY368322 — EU637994 EU637958 — EU637961 — AF137211 AY141260 EU638073 EU638041 AY362289 EU638071 EU638068 — — EU638051 — — EU638050 — — — DQ168124 DQ168089 — — — — — DQ168067 DQ168066 — — — EU638270 EU638227 — — — — — — — — Carapidae Carapidea Ophidiidae Encheliophis boroborensis (Kaup, 1856) Echiodon cryomargarites Markle, Williams & Olney,1983 Lamprogrammus scherbachevi Cohen & Rohr, 1993 — EU637956 EU637969 — — EU638058 — — EU638130 EU638179 — — Bythitidae Cataetyx laticeps Koefoed, 1927 EU637947 EU638035 — — Batrachoididae Halobatrachus didactylus (Bloch Schneider, 1801) AY368323 AY362246 DQ168069 EU638205 Lophiidae Lophiidae Lophius budegassa Spinola, 1807 Lophius piscatorius L., 1758 — AY368325 — AY362274 — — EU638217 — Antennariidae Antennarius striatus (Shaw, 1794) AY368324 AY362215 DQ168037 — Himantolophidae Ceratiidae Himantolophus groenlandicus Reinhardt,1837 Ceratias holboelli Krøyer, 1845 EU637965 AY141263 EU638055 AY362270 EU638125 DQ168049 — EU638181 Mugilidae Liza sp. AY141266 AY362248 DQ168082 — Atherinopsidae Bedotiidae Menidia menidia (L., 1766) Bedotia geayi Pellegrin, 1907 EU637977 AY141267 EU638067 AY362271 EU638137 DQ168043 — — Adrianichthyidae Exocoetidae Belonidae Oryzias latipes (Temminck Cheilopogon heterurus (Rafinesque, 1810) Belone belone (L., 1761) Schlegel, 1946) EU637950 AY141268 — EU638039 AY362273 — DQ168094 EU638113 DQ168044 Ensembl EU638184 — Anablepidae Poeciliidae Anableps anableps (L., 1758) Poecilia reticulata Peters, 1859 EU637935 Y11147 — AY362203 — DQ168102 — EU638243 Rondeletia sp. Barbourisia rufa Parr, 1945 AY368327 AY368333 EU638087 AY362264 DQ168110 — DQ168041 — (continued on next page) Argentiniformes Alepocephaloidei Stomiiformes Gonostomatoidei Aulopiformes Chlorophthalmoidei Ipnopidae Myctophiformes Lampriformes Polymixiiformes Percopsiformes Gadiformes Ophidiiformes Ophidioidei Bythitoidei Batrachoidiformes Lophiiformes Lophioidei Antennarioidei Ogcocephaloidei Mugiliformes Atheriniformes Beloniformes Cyprinodontiformes Stephanoberyciformes Rondeletiidae Barbourisiidae B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 348 Table 2 (continued) Order/suborder Family Genus/species Rhosopsin MLL IRBP RNF213 Anomalopidae Diretmidae Trachichthyidae Trachichthyidae Photoblepharon palpebratum (Boddaert, 1781) Diretmoides sp. Hoplostethus atlanticus Collett, 1889 Hoplostethus mediterraneus Cuvier, 1829 EU637993 — — AY141264 AY362268 AY362205 — AY362267 DQ168101 DQ168060 EU638127 — EU638242 — EU638207 — Berycidae Beryx splendens Lowe, 1834 AY141265 AY362238 DQ168045 EU638174 Holocentridae Holocentridae Myripristis botche Cuvier, 1929 Myripristis sp. — EU637983 AY362265 — DQ168091 — — EU638230 Oreosomatidae Grammicolepididae Zeidae Zeidae Neocyttus helgae (Holt Byrne, 1908) Grammicolepis brachiusculus Poey, 1873 Zenopsis conchifera (Lowe, 1852) Zeus faber L., 1758 AY141261 EU637964 AY368314 EU638023 AY362288 EU638054 AY362286 AY362287 — EU638124 DQ168127 DQ168128 — — EU638279 — Gasterosteidae Gasterosteidae Indostomidae Gasterosteus aculeatus L., 1758 Spinachia spinachia (L., 1758) Indostomus paradoxus Prashad & Mukerji, 1929 EU637962 AY141281 EU637967 EU638052 AY362261 EU638057 Ensembl — — Ensembl EU638264 EU638209 Syngnathidae Syngnathidae Syngnathidae Syngnathidae Fistulariidae Aulostomidae Centriscidae Centriscidae Hippocampus guttulatus Cuvier, 1829 Nerophis lumbriciformis (Jenyns, 1835) Nerophis ophidion (L., 1758) Syngnathus typhle L., 1758 Fistularia petimba Lacèpède, 1803 Aulostomus chinensis (L., 1766) Aeoliscus strigatus (Günther, 1861) Macroramphosus scolopax (L., 1758) AY368330 EU637987 — AY368326 AY141324 AY141279 EU637931 AY141280 AY362216 — — AY362211 — AY362226 — AY362206 EU638126 EU638143 DQ168071 DQ168120 — DQ168040 EU638100 DQ168083 — EU638232 — — EU638202 — — — Symbranchidae Monopterus albus (Zuiew, 1793) AY141276 AY362252 DQ168088 EU638226 Mastacembelidae Mastacembelus erythrotaenia Bleeker, 1850 AY141275 AY362249 DQ168084 — Dactylopteridae Dactylopterus volitans (L., 1758) AY141282 AY362243 DQ168059 — Sebastidae Scorpaenidae Scorpaenidae Synanceiidae Congiopodidae Sebastes sp. Pontinus longispinis Goode Bean, 1896 Scorpaena onaria Jordan Snyder, 1900 Synanceia verrucosa Bloc Schneider, 1801 Zanclorhynchus spinifer Gúnther, 1880 — EU637996 AY141288 EU638011 EU638021 — EU638081 AY362236 EU638093 — — EU638146 DQ168114 EU638156 EU638165 EU638258 EU638247 EU638257 EU638267 EU638278 Triglidae Chelidonichthys lucernus (L., 1758) AY141287 AY362284 DQ168053 EU638186 Cottidae Agonidae Agonidae Psychrolutidae Cyclopteridae Liparidae Taurulus bubalis Euphrasen, 1786) Agonopsis chiloensis (Jenyns, 1840) Xeneretmus latifrons (Gilbert, 1890) Cottunculus thomsonii (Günther, 1882) Cyclopterus lumpus L., 1758 Liparis fabricii Krøyer, 1847 U97275 EU637932 EU638018 AY368315 AY368316 AY368317 AY362217 EU638025 EU638097 AY362260 AY362218 AY362235 DQ168121 EU638101 EU638162 — EU638116 DQ168081 — EU638167 — — — — Centropomidae Lateolabracidae Latidae Latidae Moronidae Moronidae Percichthyidae Serranidae Serranidae Serranidae Serranidae Serranidae Serranidae Serranidae Serranidae Serranidae Serranidae Centropomus undecimalis (Bloch, 1792) Lateolabrax japonicus (Cuvier, 1828) Lates calcarifer (Bloch, 1970) Lates niloticus (L., 1758) Dicentrarchus labrax (L., 1758) Morone saxatilis (Walbaum, 1792) Howella brodiei (Ogilby, 1899) Acanthistius brasilianus (Cuvier, 1828) Cephalopholis urodeta (Forster, 1801) Dermatolepis dermatolepis (Boulenger, 1895) Epinephelus aeneus (Geoffroy Saint-Hilaire, 1817) Odontanthias chrysostictus (Günther, 1872) Liopropoma fasciatum Bussing, 1980 Niphon spinosus Cuvier, 1828 Plectropomus leopardus (Lacèpède, 1802) Pogonoperca punctata (Valenciennes, 1830) Pseudanthias squamipinnis (Peters, 1855) — AY141293 EU637970 EU637971 — EU637981 EU637966 — — — AY141291 AY141290 — EU637934 — AY141292 — — AY362253 EU638059 — — EU638072 EU638056 EU638024 EU638036 EU638045 EU638049 AY362209 EU638062 — EU638078 AY362256 EU638083 — DQ168078 DQ168075 — EU638119 EU638140 EU638128 — — — AY362227 DQ168073 — — — DQ168103 — EU638180 EU638213 EU638214 — EU638195 EU638228 EU638208 — — — EU638201 EU638206 — — — EU638244 — Beryciformes Trachichthyoidei Berycoidei Holocentroidei Zeiformes Gasterosteiformes Gasterosteoidei Syngnathoidei Symbranchiformes Symbranchoidei Mastacembeloidei Scorpaeniformes Dactylopteroidei Scorpaenoidei Platycephaloidei Cottoidei Perciformes Percoidei B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 349 Table 2 (continued) Order/suborder Family Genus/species Rhosopsin MLL IRBP RNF213 Serranidae Serranidae Callanthiidae Plesiopidae Centrarchidae Percidae Percidae Priacanthidae Epigonidae Apogonidae Apogonidae Malacanthidae Sillaginidae Coryphaenidae Coryphaenidae Echeneidae Carangidae Carangidae Carangidae Carangidae Carangidae Menidae Leiognathidae Bramidae Lutjanidae Lutjanidae Caesionidae Datnioididae Haemulidae Sparidae Sciaenidae Sciaenidae Sciaenidae Sciaenidae Sciaenidae Polynemidae Mullidae Toxotidae Monodactylidae Kyphosidae Chaetodontidae Drepaneidae Pomacanthidae Pomacanthidae Terapontidae Cheilodactylidae Aplodactylidae Cepolidae Rypticus saponaceus (Bloch Schneider, 1801) Serranus accraensis (Norman, 1931) Callanthias ruber (Rafinesque, 1810) Assessor flavissimus Allen Kuiter, 1976 Lepomis gibbosus (L., 1758) Gymnocephalus cernuus (L., 1758) Perca fluviatilis L., 1758 Priacanthus arenatus Cuvier, 1829 Epigonus telescopus (Risso, 1810) Apogon fasciatus (White, 1970) Sphaeramia nematoptera (Bleeker, 1856) Lopholatilus chamaeleonticeps Goode & Bean, 1879 Sillago sihama (Forsskål, 1775) Coryphaena equiselis L., 1758 Coryphaena hippurus L., 1758 Echeneis naucrates L., 1758 Chloroscombrus chrysurus (L., 1766) Gnathanodon speciosus (Forsskål, 1755) Selene dorsalis (Gill, 1863) Trachinotus ovatus (L., 1758) Trachurus trachurus (L., 1758) Mene maculata (Bloch & Schneider, 1801) Leiognathus fasciatus (Lacépède, 1803) Pterycombus brama Fries, 1837 Apsilus fuscus Valenciennes, 1830 Lutjanus sebae (Cuvier, 1816) Pterocaesio digramma (Bleeker, 1864) Datnioides polota (Hamilton, 1822) Pomadasys perotaei (Cuvier, 1830) Spondyliosoma cantharus (L., 1758) Argyrosomus regius (Asso, 1801) Johnius sp. Bloch, 1793 Micropogonias furnieri (Desmarest, 1823) Micropogonias sp. Sciaena sp. Pentanemus quinquarius (L., 1758) Mullus surmuletus L., 1758 Toxotes sp. Monodactylus sp. Lacépède, 1801 Microcanthus strigatus (Cuvier, 1831) Chaetodon semilarvatus Cuvier, 1831 Drepane africana Osório, 1892 Holacanthus ciliaris (L., 1758) Pomacanthus maculosus (Forsskål, 1775) Pelates quadrilineatus (Bloch, 1790) Nemadactylus monodactylus (Carmichael, 1819) Aplodactylus punctatus Valenciennes, 1832 Cepola macrophthalma (L., 1758) AY368329 AY141289 EU637945 EU637944 AY742571 AY141296 AY141295 EU637997 EU637959 EU637940 EU638010 EU637973 EU638008 EU637951 — AY141315 AY141313 EU637963 EU638006 AY141314 EU638013 AY141316 EU637972 EU638001 AY362257 AY362202 EU638034 EU638110 EU638032 EU638061 AY362278 AY362279 EU638082 EU638048 — EU638091 EU638063 — EU638040 — AY362245 AY362223 EU638053 EU638089 AY362263 — AY362250 EU638060 EU638086 DQ168111 DQ168115 — EU638109 EU638132 DQ168068 DQ168099 EU638147 EU638122 — EU638154 EU638133 — EU638114 DQ168056 DQ168062 DQ168054 EU638123 EU638153 DQ168120 EU638159 DQ168085 EU638131 EU638149 EU638253 EU638260 EU638173 EU638216 — EU638240 — EU638200 EU638171 — EU638218 EU638262 EU638189 — EU638197 EU638187 EU638204 EU638259 — EU638269 EU638221 — EU638251 EU637974 EU638000 EU637954 — — EU637942 — EU637979 — EU638004 AY141317 EU637982 EU638012 EU637980 EU637978 AY368312 AY141321 AY141322 EU637995 EU637991 EU637985 EU637939 EU637948 EU638064 EU638085 EU638044 AY362230 EU638092 EU638030 — — — — AY362272 AY362231 EU638094 EU638070 EU638069 AY362240 AY362244 AY362214 EU638079 — EU638075 — EU638037 EU638134 EU638148 EU638118 DQ168105 EU638155 EU638107 EU638129 — — — DQ168098 DQ168090 EU638157 EU638139 EU638138 DQ168050 DQ168061 DQ168072 EU638145 — EU638142 — EU638111 EU638219 EU638250 EU638194 EU638246 EU638265 EU638172 — — EU638224 — EU638239 EU638229 — — EU638222 — EU638196 — EU638245 — EU638231 — — Elassomatidae Elassoma zonatum Jordan, 1877 EU637957 — DQ168063 — Cichlidae Cichlidae Pomacentridae Labridae Labridae Scaridae Haplochromis nubilus (Boulenger, 1906) Haplochromis sp. Dascyllus trimaculatus (Rüppenl, 1829) Labrus bergylta Ascanius, 1767 Xyrichtys novacula (L., 1758) Scarus hoefleri (Steindachner, 1881) — AB084933 EU637953 AY141318 EU638020 AY141319 — — EU638043 AY362222 — AY362212 DQ168070 — EU638117 DQ168075 EU638164 DQ168112 — — EU638193 EU638211 EU638277 EU638254 Zoarcidae Zoarcidae Pholidae Anarhichadidae Austrolycus depressiceps Regan, 1913 Lycodapus antarcticus Tomo, 1982 Pholis gunnellus (L., 1758) Anarhichas lupus L., 1758 AY141297 EU637976 AY141298 EU637936 — EU638066 AY362285 EU638026 — EU638136 DQ168100 EU638103 — — EU638241 EU638169 Nototheniidae Nototheniidae Bovichtidae Bovichtidae Bovichtidae Eleginopsidae Channichthyidae Channichthyidae Channichthyidae Notothenia coriiceps Richardson, 1844 Trematomus bernachii Boulenger, 1902 Bovichtus variegatus Richardson, 1846 Cottoperca trigliodes (Forster, 1801) Pseudaphritis urvillii (Valenciennes, 1832) Eleginops maclovinus (Cuvier, 1830) Chionodraco hamatus (Lönnberg, 1905) Neopagetopsis ionah Nybelin, 1947 Pagetopsis macropterus (Boulenger, 1907) AY141302 EU638014 AY141299 AY141300 AY141301 AY141303 AY362280 EU637986 EU637990 AY362282 — AY362283 — — EU638047 — AY362281 EU638076 DQ168093 EU638160 DQ168046 — — EU638121 — DQ16802 EU638144 — EU638271 EU638176 — — EU638199 Chiasmodontidae Kali macrura (Parr, 1933) AY141308 AY362224 DQ168074 EU638210 (continued on next page) Elassomatoidei Labroidei Zoarcoidei Notothenioidei — EU638235 Trachinoidei B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 350 Table 2 (continued) Order/suborder Family Genus/species Rhosopsin MLL IRBP RNF213 Champsodontidae Pinguipedidae Pinguipedidae Cheimarrichthyidae Trachinidae Trachinidae Ammodytidae Uranoscopidae Champsodon snyderi Franz, 1910 Parapercis clathrata Ogilby, 1910 Pinguipes chilensis Valenciennes, 1833 Cheimarrichthys fosteri Haast, 1874 Echiichthys vipera (Cuvier, 1829) Trachinus draco L., 1758 Ammodytes tobianus L., 1758 Uranoscopus albesca Regan, 1915 EU637949 — EU637989 AY141307 EU637955 AY141304 AY141306 AY141305 EU638038 EU638077 — AY362229 EU638046 AY362277 AY362234 AY362239 — — — DQ168052 EU638120 DQ168123 EU638102 DQ168126 EU638182 EU638238 EU638234 EU638185 EU638198 EU638268 EU638168 EU638275 Tripterygiidae Tripterygiidae Blenniidae Blenniidae Forsterygion lapillum Hardy, 1989 Tripterygion delaisi Cadenat & Blache, 1970 Parablennius gattorugine (L., 1758) Salaria pavo (Risso, 1810) AY141272 EU638016 AY141271 Y18674 AY362276 — AY362255 — DQ168065 — DQ168097 — EU638203 EU638274 EU638237 — Gobiesocidae Gobiesocidae Gobiesocidae Apletodon dentatus (Facciolà, 1887) Aspasma minima (Döderlein, 1887) Lepadogaster lepadogaster (Bonnaterre, 1788) AY141274 EU637943 AY141273 AY362213 EU638031 AY362247 DQ168039 EU638108 DQ168080 — — EU638215 Callionymidae Callionymidae Callionymus lyra L., 1758 Callionymus schaapii Bleeker, 1852 AY141270 EU637946 AY362225 — DQ168047 — EU638177 — Eleotridae Gobiidae Gobiidae Gobiidae Gobiidae Gobiidae Microdesmidae Ophiocara porocephala (Valenciennes, 1837) Favonigobius reichei (Bleeker, 1853) Periophthalmus barbarus (L., 1766) Pomatoschistus minutus (Pallas, 1770) Pomatoschistus sp. Gill, 1863 Valenciennea strigata (Broussonet, 1782) Ptereleotris zebra (Fowler, 1938) EU637988 EU637960 EU637992 X62405 — EU638017 EU637999 — — — — EU638080 — EU638084 — — — — DQ168106 — — — — — — — — — Scatophagidae Siganidae Luvaridae Acanthuridae Acanthuridae Acanthuridae Selenotoca multifasciata (Richardson, 1846) Siganus vulpinus (Schlegel & Müller, 1845) Luvarus imperialis Rafinesque, 1810 Ctenochaetus sp. Ctenochaetus striatus (Quoy & Gaimard, 1825) Naso lituratus (Forster, 1801) EU638002 EU638007 EU637975 — AY141320 EU637984 EU638088 EU638090 EU638065 — AY362242 EU638074 EU638150 DQ168116 EU638135 — DQ168057 EU638141 — EU638261 EU638220 EU638190 — — Sphyraenidae Trichiuridae Scombridae Xiphiidae Sphyraena sphyraena (L., 1758) Aphanopus carbo Lowe, 1839 Scomber japonicus Houttuyn, 1782 Xiphias gladius L., 1758 AY141312 EU637938 AY141311 EU638019 AY362254 EU638028 AY362237 EU638098 DQ168118 EU638105 DQ168113 EU638163 EU638263 EU638170 — EU638276 Centrolophidae Centrolophidae Nomeidae Stromateidae Psenopsis anomala (Temminck & Schlegel, 1844) Schedophilus medusophagus (Cocco, 1839) Cubiceps gracilis (Lowe, 1843) Pampus argenteus (Euphrasen, 1788) AY141310 EU638003 EU637952 AY141309 AY362269 EU660040 EU638042 AY362220 DQ168107 EU638151 EU638115 DQ168096 EU638248 EU638255 EU638192 EU638236 Anabantidae Ctenopoma sp. AY141278 AY362210 DQ168058 EU638191 Channidae Channidae Channa sp. Channa striata (Bloch, 1793) — AY141277 — AY362241 — DQ168051 EU638183 — Caproidae Caproidae Antigonia capros Lowe, 1843 Capros aper (L., 1758) EU637937 AY141262 EU638027 AY362233 EU638104 DQ168048 — EU638178 Psettodidae Psettodes belcheri Bennett, 1831 EU637998 AY362259 DQ168108 EU638249 Citharidae Paralichthyidae Scophthalmidae Scophthalmidae Bothidae Bothidae Achiridae Soleidae Soleidae Soleidae Citharus linguatula (L., 1758) Syacium micrurum Ranzani, 1842 Scophthalmus rhombus (L., 1758) Zeugopterus punctatus (Bloch, 1787) Arnoglossus imperialis (Rafinesque, 1810) Bothus podas (Delaroche, 1809) Trinectes maculatus (Bloch & Schneider, 1801) Microchirus frechkopi Chabanaud, 1952 Microchirus variegatus (Donovan, 1808) Solea solea (L., 1758) AY141323 AY368334 EU638005 EU638022 AY141283 AY368313 EU638015 — AY141284 EU638009 AY362232 AY362262 — EU638099 AY362228 EU638033 EU638096 — AY362275 — DQ168055 DQ168119 EU638152 EU638166 — — EU638161 — DQ168086 DQ168117 EU638188 EU638266 EU638256 EU638280 — EU638175 EU638273 EU638223 — — Triacanthodidae Triacanthodidae Triacanthodes anomalus (Temminck & Schlegel, 1850) Triacanthodes sp. — AY368331 EU638095 — — DQ168125 EU638272 — Blennioidei Gobiesocoidei Callionymoidei Gobioidei Acanthuroidei Scombroidei Stromateoidei Anabantoidei Channoidei Caproidei Pleuronectiformes Psettodoidei Pleuronectoidei Tetraodontiformes Triacanthodoidei B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 351 Table 2 (continued) Order/suborder Family Genus/species Rhosopsin MLL IRBP RNF213 Balistidae Ostraciidae Ostraciidae Balistes sp. Ostracion cubicus L., 1758 Ostracion sp. AF137212 — AF137213 — — AY362207 — — DQ168095 — EU638233 — Tetraodontidae Tetraodontidae Tetraodontidae Tetraodontidae Molidae Lagocephalus laevigatus (L., 1766) Lagocephalus lagocephalus (L., 1758) Takifugu rubripes (Temminck & Schlegel, 1850) Tetraodon nigroviridis Marion de Procé, 1822 Mola mola (L., 1758) — EU637968 — Ensembl AF137215 AY362221 — Ensembl Ensembl AY362251 DQ168076 — Ensembl Ensembl DQ168087 — EU638212 Ensembl Ensembl EU638225 Balistoidei Tetraodontoidei The primers published in Chen et al. (2003) for Rhodopsin, in Dettaï and Lecointre (2005) for MLL and in Dettaï and Lecointre (2008) for IRBP were used, but 4 new primers were designed for MLL in order to obtain more gadiform sequences, and 6 new primers were used to amplify the new RNF213 marker (Table 1). Most RNF213 sequences could be obtained with primers C17 F3111 and C17 R4111. Various PCR conditions were used, depending on the primers and the DNA sample. Three different polymerases were used for the PCRs: Taq Appligen, QbioTaq and Taq Qiagen. PCRs began with a denaturation phase at 94 °C for 2–5 min and ended with a final elongation phase at 72 °C (or 68 °C for the longest PCRs using Taq Qiagen) for 4–7 min. Cycles began with a denaturation phase at 94 °C for 20–40 s, followed by an annealing phase at temperatures ranging from 47 to 60 °C and during from 25 to 45 s. The annealing phase was followed by an elongation phase at 72 °C (or 68 °C for the longest PCRs using Taq Qiagen) for 35 s to 2 min. The number of cycles ranged from 35 to 60. Purification and sequencing of the PCRs were performed at the Genoscope (http://www.genoscope.cns.fr/). The same primers were used for PCR and sequencing. Sequences were checked individually using Sequencher (Gene Codes Corporation) and aligned by hand using Se-Al (Rambaut, 2002). Indels were grouped by 3 so as to fit the coding frame, and adjusted according to the translation in amino acid sequences. Characteristics of the aligned markers are given in Table 3. Preliminary distance trees were done using PAUP (Swofford, 2002) to check for contaminations. Accession numbers are given in Table 2. 2.3. Analysis strategy When a clade contradicts the previously supported phylogenetic hypotheses, it is necessary to check whether this is due to an artifact. Those can be detected by using different taxonomic samplings, tree reconstruction methods, or, more reliably, by comparing the topology to the one inferred from an independent data- set. This is the primary reason to perform separate analyses in molecular phylogenetics. If selective pressures characterizing mutational space at each position are relatively homogeneous within genes but heterogeneous among genes, the fact that a given clade is recurrently recovered from independent markers is a strong indication of its reliability (Nelson, 1979; Chen et al., 2003; Dettaï and Lecointre, 2004, 2005). Indeed, finding a clade twice independently just by chance is very improbable (Page and Holmes, 1998), and the probability of obtaining exactly the same tree reconstruction artifact from independent genes is also low, although sometimes the notorious long branch attraction artifact can occur with several markers when higher mutation rates affect large parts of the genome of several of the included species. Separate analyses tend to be more subject to stochastic errors (because of the shorter length of the analyzed sequences), but also prone to marker-specific biases. The recovery of a clade in separate analyses of several independent markers in spite of these problems is therefore a strong indication of the reliability of the clade. This led to the definition of a repetition index based on the number of occurrences of a clade across independent analyses (Li and Lecointre, 2008). This can also be used to detect instances where the markers reflect distinct and incompatible histories. Repetition across trees based on independent data is a better indicator than bootstrap proportions extracted from a crude ‘total evidence’ (for a review of the origins of that term, see Rieppel, 2004; Lecointre and Deleporte, 2005), because tree reconstruction artifacts can lead to clades with high robustness (Philippe and Douzery, 1994). Additionally, a positively misleading signal from a single gene can impose the topology of some parts of the tree inferred from the combined data (Grande, 1994; Chen et al., 2000, 2003; Chen, 2001). Separate analyses of independent partitions are an efficient way to assess the reliability of clades and to identify marker-specific reconstruction artifacts. However, as mentioned above, keeping partitions separate has its own risks (see review in Miyamoto and Fitch, 1995; Lecointre and Deleporte, 2005). To circumvent these problems, it is interest- Table 3 Characteristics of the datasets used in this study. The statistics were computed using p4 version 0.86.r43 (Foster, 2004, http://bmnh.org/pf/p4.html). Number of sequences (new ones) Rhodopsin MLL IRBP RNF213 190 (92) 165 (77) 161 (66) 118 (114) 856 572 (66.8%) 469 (54.7%) 730 542 (74.2%) 468 (64.1%) 828 684 (82.6%) 557 (67.2%) 991 799 (80.6%) 727 (73.3%) Mean Minimum Maximum 0.214861 0.007009 0.857477 0.267751 0.004644 0.604380 0.225977 0.013285 0.524155 0.220434 0.015228 0.773604 Global First codon Second codon Third codon 0.000015 1.000000 1.000000 0.000000 0.922810 1.000000 1.000000 0.000000 0.614509 1.000000 1.000000 0.000000 1.000000 1.000000 1.000000 0.117940 9 10 2 3 Alignment length Variable sites Informative sites Pairwise differences P-value of v2 homogeneity tests Location (Tetraderon chromosome) 352 B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 ing to perform both separate and simultaneous analyses (Mickevich, 1978; Bull et al., 1993; Miyamoto and Fitch, 1995). (Dettaï and Lecointre, 2004 Fig. 2 therein), Dettaï and Lecointre (2005) and Li and Lecointre (2008) proposed partial combinations as a way to explore marker-specific topologies and to assess the reliability of clades. In their approach, not only is each elementary dataset analyzed separately, but every possible combination of the datasets is produced and analyzed too. However, counting occurrences makes sense only when the trees taken into account are based on independent data. The minimal independent data units (elementary datasets) and their combinations are grouped into various sets of datasets: the partitioning schemes. A partitioning scheme, contains independent non overlapping datasets (elementary datasets or combinations thereof, see Li and Lecointre, 2008). For example, among all possible combinations of our datasets, RNF213 and the combination of the three other markers together form a partitioning scheme because the two parts do not contain elementary datasets in common. The number of clade occurrences may be then counted over the two trees obtained from these datasets. In the present study, we used this approach, analyzing every possible combination of the datasets and recording repeated clades from combinations having no marker in common. This allows to take into account both the strengths and the weaknesses of separate and simultaneous analyses. The four nuclear markers were thus assembled in 15 combinations of one to four elementary datasets. 2.4. Datasets design All genera for which we could obtain sequence data for at least one of the four nuclear markers were used in this study, in order to cover a broad taxonomic area, and because it has been shown that even a single sequence can still convey relevant information for the phylogenetic analyses (Wiens and Reeder, 1995). Nonetheless, missing data can sometimes disturb phylogenetic reconstruction, therefore, we made a decision about the minimum amount of sequences that need to be present for a taxon to be included in a dataset. The taxa for which half the markers (or more) were missing for a given combination were not included in that combination. This means that in a combination, a terminal must have sequences for at least two of the markers in a combination of 2 or 3 markers, and sequences for 3 or 4 markers for the combination of the 4 markers. For a few taxa, the sequences for different genes were obtained from different species of the same genus. Using such chimeric sequences at the species level for a study at the interfamilial level should not be problematic. For Callionymus, Coryphaena and Nerophis, species were not fused in a chimeric sequence because this would not have led to a better taxonomic overlap between the different markers: Callionymus lyra was present for the four markers while C. schaapii was present for Rhodopsin only, Coryphaena equiselis was present for the four markers while C. hippurus was present for IRBP only, and Nerophis lumbriciformis was present for RNF213, IRBP and Rhodopsin while N. ophiodon was present for IRBP only. 2.5. Primary analyses Considering the taxonomic scale of our study, sequence data were analyzed under probabilistic sequence evolution models. PhyML (Guindon and Gascuel, 2003) was used for its speed, with a GTR + I + C model. To offer an assessment of the role played by the RNF213 sequence data in the resolution of the ‘acanthomorph bush’, four trees were compared: the tree based on the new RNF213 sequence data, the tree based on the combination of the three other nuclear markers, the tree based on the combination of all four datasets (the ‘total evidence’ tree) and an MRP-like supertree displaying/summarizing the reliable clades calculated from the repetition indices of Li and Lecointre (2008), based on partial combinations and validity domains for the four datasets studied here. 2.6. Validity domains: adapting Li and Lecointre’s method to datasets with different sets of taxa To evaluate the reliability of clades, Li and Lecointre (2008) proposed repetition indices based on the partial combinations strategy (Dettaï and Lecointre, 2004). However, the proposed indices are only valid when all trees to be compared have the same set of terminals. Here, restricting all analyses to genera present in all four elementary datasets would have resulted in discarding nearly half the taxa, a considerable loss of information. To avoid this problem, we adopted here a pruning strategy based on three levels of what we call ‘validity domains’ (Fig. 1). Analyses of the various dataset combinations were done on different sets of taxa, depending on the proportion of available sequences for a given taxon in the combined datasets. The sets of taxa included in each separate and combined analysis are called the ‘first-level validity domains’ (validity domains of the primary analyses). As stated earlier, we decided to take into account the taxa present in at least half the elementary datasets of a given combination. With three elementary datasets A; B and C, noting V A ; V B and V C their validity domains, the validity domain of A [ B [ C would be: V A[B[C ¼ ðV A \ V B Þ [ ðV A \ V C Þ [ ðV B \ V C Þ (that is, the taxa that are either in A and B, in A and C or in B and C). These validity domains are, logically, also the sets of leaves of the trees resulting from the primary analyses. The number of occurrences of the clades are counted over collections of such trees (see Fig. 1). But a clade can be recognized and counted only when the trees are defined on the same set of taxa. As the count is performed within a partitioning scheme (a set of independent, non overlapping datasets, see above), the sampling for a given partitioning scheme has to be reduced to the taxa shared by all trees of the Fig. 1. The 3 levels of validity domains. The first-level validity domains ðV X Þ are the sets of leaves of the trees ðT X Þ obtained by the analyses of the datasets ðXÞ. In this example, 3 elementary datasets are used, which leads to 7 datasets, and thus to 7 trees and 7 first-level validity domains. The second-level validity domains ðV PSci Þ are the intersections of the validity domains of the independant datasets involved in the partitioning schemes ðPSci Þ. Here, only the full partitioning schemes are shown. The occurrences of the clades are counted within a partitioning scheme, across its constituent datasets, after pruning the corresponding trees of the taxa outside the relevant second-level validity domain. The third-level validity domains ðW i Þ are the intersections of all possible combinations of second-level validity domains. The repetition indices are attached to such third-level validity domains. They are based on the maximum number of occurrences (for the clades once pruned of the taxa outside the third-level validity domain) found among the partitioning schemes whose validity domains span at least the entire third-level validity domain. Only some of the possible third-level validity domains are shown here. B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 scheme. This is a ‘second-level validity domain’. It is associated to the partitioning scheme through a process we call ‘prune-tocount’. Taxa that are not in all datasets in the partitioning scheme are pruned from the trees. If we note PSc2 partitioning scheme ðA; B [ CÞ, the corresponding second-level validity domain (Fig. 1) would be: V PSc2 ¼ V A \ V B[C : In addition to using the definition of partitioning schemes of Li and Lecointre (2008), we also took into account all the ‘partial partitioning schemes’ (not shown in Fig. 1). These do not include all elementary datasets but have a larger second-level validity domain (a larger shared taxonomic sampling) than full partitioning schemes. This has the advantage of retaining more information about potentially reliable relationships. The repetition index for a clade (Li and Lecointre, 2008) involves a comparison between the best number of occurrences of the clade across all possible partitioning schemes and the best number of occurrences of its contradictors. 353 But here, different partitioning schemes (PSc1 ; PSc2 , PSc3 , etc.) can have different taxonomic samplings. The repetition index could be computed in the set of taxa common to all partitioning schemes, but this would entail an important loss of terminals. Therefore, the repetition index was also computed using all possible smaller sets of partitioning schemes, which potentially have a higher number of shared terminals. Computing a repetition index which takes into account a given set of partitioning schemes, requires restricting the analysis (in terms of terminals) to the intersection of the validity domains of these partitioning schemes. This second pruning step is performed in order to be able to compare clades from the different partitioning schemes of the set. We call it a ‘prune-to-compare’ process: if PSc1 ; PSc3 and PSc4 are the partitioning schemes from which the clades to be compared are drawn, the comparison is made in a ‘third-level validity domain’ (noted W 1 , Fig. 1): W 1 ¼ V PSc1 \ V PSc3 \ V PSc4 : Fig. 2. Maximum likelihood tree obtained by the analysis of the new RNF213 sequence data matrix under a GTR + I + C model with phyML Guindon and Gascuel (2003). Bootstrap proportions are reported for clades over 70%. 354 B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 Fig. 3. Maximum likelihood tree obtained by the analysis of the combined matrix Rhodopsin + MLL + IRBP under a GTR + I + C model with phyML Guindon and Gascuel (2003). Bootstrap proportions are reported for clades over 70%. Table 4 Clades of interest extracted from the separate and multiple combined analyses and repetition index. New names are proposed for some of those reliable clades of the ‘acanthomorph bush’. First column lists the contents of the clade; the name given to the clade refers to the last common ancestor to the taxa indicated. Second column indicates by a cross the presence of the clade in Fig. 2. A blank means that the clade is not recovered in the tree Fig. 2 and a question mark indicates that the presence of the clade cannot be assessed either because of an incomplete taxonomic sampling or because of irresolution. Third column indicates presence of clades in Fig. 3. Fourth column indicates presence of clades in Fig. 4. The mention ‘x 1’ indicates that a single taxon escapes from the clade (generally a long branch). Fifth column indicates presence of the clade in the summary tree of Fig. 5. Sixth column gives the letter associated to the clade in Chen et al. (2003) and Dettaı̈ and Lecointre (2005, 2008) and proposes letters for new clades (P, P0 , R, S, T, U, V, W, Y, Z, L0 , L00 , M0 , M00 ). Seventh column refers to the presence of the clade in the study of Dettaı̈ and Lecointre (2008) based on the IRBP gene. Eighth column records the clade in the studies of Miya et al. (2003, 2005) based on independent mitochondrial sequence data; ninth column in the study of Mabuchi et al. (2007) using the same genes as in Miya et al. (2005) and tenth column in the study of Kawahara et al. (2008) also based on the same markers. Eleventh column records the clades in the study of Smith and Craig (2007) based on mitochondrial and nuclear data independent from both Dettaı̈ and Lecointre (2005) and Miya et al. (2005). In these last five columns, question marks are given either when taxonomic sampling is insufficient or the interrelationships unresolved. The last column proposes a name to some of the clades that have been repeatedly found in several previous studies, or reliable clades newly identified by the present study. Fig. 2 Fig. 3 Fig. 4 Fig. 5 Nomenclature (Chen et al. and this study) Dettaı¨ and Lecointre (2008) Miya et al. (2003, 2005) Mabuchi et al. (2007) Kawahara et al. (2008) Smith and Craig (2007) Names (new ones in bold) Zeioidei, Gadiformes Zeioidei, Gadiformes, Polymixiiformes Lampridiformes, Percopsiformes Lampridiformes, Percopsiformes, Polymixiiformes Zeioidei, Gadiformes, Polymixiiformes, Lampridiformes, Percopsiformes Trachichthyoidei, Berycoidei, Holocentroidei x ? ? ? ? x x x A O x ? ? ? x x x P x ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? Zeioigadiformes ? ? ? x x x x ? ? ? Beryciformes (after Chen et al., 2003) P sister-group of the rest of acanthomorpha Ophidiiformes sister-group of non-P and non beryciform and non Stephanoberyciformes acanthomorphs ? Mugiloidei, Atherinomorpha Blennioidei, Gobiesocoidei Mugiloidei, Plesiopidae Mugiloidei, Plesiopidae, Blenniiformes, Atherinomorpha, Cichlidae Apogonidae, Gobioidei Syngnathidae, Callionymoidei, Mullidae Centrolophidae, Bramidae, Nomeidae, Scombridae, Trichiuridae, Chiasmodontidae Stromateidae, Centrolophidae, Bramidae, Nomeidae, Scombridae, Trichiuriae, Chiasmodontidae Dactylopteridae, Aulostomidae, Macrorhamphosidae Stromateoidei + E Channidae, Anabantidae Symbranchidae, Mastacembelidae Channidae, Anabantidae, Mastacembelidae, Symbranchidae, Indostomidae Uranoscopidae, Ammodytidae, Cheimarrichthyidae, Pinguipedidae Sciaenidae, Haemulidae Centrarchidae, Moronidae, Elassomatidae Cottoidei, Zoarcoidei Zoarcoidei, Gasterosteidae Cottoidei, Zoarcoidei, Gasterosteidae Cottoidei, Zoarcoidei, Gasterosteidae, Triglidae Cottoidei, Zoarcoidei, Gasterosteidae, Triglidae, Scorpaenidae, Sebastidae, Synanceiidae, Congiopodidae Notothenioidei, Percophidae ? ? ? x B x x x x x x P0 x ? ? x ? x ? x ? ? x x x x x x x x1 C D Y Q ? x ? x ? x ? x? x ? x? x ? B? ? ? ? x? x W E0 U ? ? ? ? ? ? ? ? ? ? ? ? ? ? ? Percomorpha (sensu Miya et al., 2003) Blenniiformes Stiassnyiformes x x x x x x x x x H x ? ? ? x? Stromateoidei, new definition ? ? x ? x x x x x x x x x x x x1 x1 x x x E S f1 f2 F ? ? x x x ? ? ? x ? ? ? ? x ? x ? ? A? A? ? ? ? Labyrinthoidei Synbranchiformes Anabantiformes x x x x G x ? ? ? x? Paratrachinoidei x x ? x x ? ? ? ? x x x x x x x x ? ? x ? ? ? ? ? ? x x x M0 M00 I J Is Isc Z x x x ? x x ? ? x x ? ? x x ? ? ? ? ? F ? ? ? ? ? ? E x x x ? x x x1 T x Zoarciformes Cottimorpha Triglimorpha Notothenioidi Smith and Craig (2007) Percoide (continued on next page) 355 Notothenioidi, Niphon, Acanthistius, Percidae Notothenioidei, Trachinidae x B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 Last common ancestor to B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 x ? x x Percichthyidae, Epigonidae, Lateolabracidae x R ? ? ? ? H + G? ? x x2 x x+1 x x1 x M x? x x? ? x? x ? ? x x x x x x x ? x V N ? x ? x? ? x? H? Labroidei sensu stricto Epigonoidei Carangimorpha x? ? E? ? x x x1 x x1 L00 L ? x? ? x? ? x x x L0 ? ? ? Serraniformes x ? G? ? ? ? ? x K X x1 x x Notothenioidei, Percidae Notothenioidei, Percidae, Triglimorpha, Trachinidae, Scorpaenidae, Sebastidae, Synanceiidae, Serranidae, Congiopodidae Carangoidei stem group of Echeneidae and Coryphaenidae Sphyraenidae sister-group of L0 Pleuronectiformes, Centropomidae, Carangidae, Coryphaenidae, Menidae, Sphyraenidae, Polynemidae, Echeneidae, Toxotidae, Xiphiidae Carangimorpha, Anabantiformes Tetraodontiformes, Lophiiformes, Caproidei, Elassomatidae, Acanthuridae, Siganidae, Pomacanthidae, Drepanidae, Chaetodontidae Extended N Labridae, Scaridae x Dettaı¨ and Lecointre (2008) Fig. 5 Last common ancestor to Table 4 (continued) Fig. 2 Fig. 3 Fig. 4 Nomenclature (Chen et al. and this study) Miya et al. (2003, 2005) Mabuchi et al. (2007) Kawahara et al. (2008) Smith and Craig (2007) Names (new ones in bold) 356 This pruning and comparing step is done for all combinations of partitioning schemes and leads to several third-level validity domains (W 1 ; W 2 ; W 3 , etc. Only some of them are represented in Fig. 1). Thus, within each W, each clade has a first order repetition index, which is the maximum number of occurrences found among the involved partitioning schemes by counting all clades corresponding to the clade under focus before the pruning process. Then, the best first order repetition index found among the contradictors of the clade under focus within the same W is subtracted from this first order repetition index as described in Li and Lecointre (2008). This procedure associates a repetition index to each clade, each association being defined in a particular W. The procedure can be summarized as follows (see also Fig. 1): 1. Analyze each dataset (elementary datasets and all possible combinations thereof). 2. Arrange the data into partitioning schemes (sets of independent datasets) and, for each of them, determine the corresponding validity domain (set of included terminals). The validity domain of a partitioning scheme (second-level validity domain, noted V PSc ) is the intersection of the validity domains of its constituent datasets (first-level validity domains, noted V). 3. For each partitioning scheme, prune the taxa not in the validity domain of the partitioning scheme from the trees and record the clades in the pruned trees with their number of occurrences (whenever a number of clade occurrences is used, a sum of support values could be used instead). 4. Combine the partitioning schemes and determine the validity domain of each of the possible combinations (third-level validity domains, noted W). The validity domain of a combination of partitioning schemes is the intersection of the validity domains of its constituent partitioning schemes. Group together combinations that have the same validity domain. 5. For each of the preceding validity domains ðWÞ, prune the taxa that are not in the validity domain from the clades found in the associated combinations of partitioning schemes. For each distinct resulting clade, keep as first order repetition index the best number of occurrences found among the clades that, once pruned, become the clade under focus. 6. Within each third-level validity domain, proceed as in Li and Lecointre (2008) to obtain the final repetition indices. In order to take robustness into account, the repetition index can also be based on sums of bootstrap proportions instead of sums of occurrences. In the present reliability analyses, to accommodate for the uncertainty entailed by the use of heavy heuristics, bipartition occurrences were weighted by their bootstrap supports across 100 resamplings. But pruning taxa from a tree causes the fusion of several internal branches. The highest bootstrap support among fused branches was used to weight the bipartition delimited by such fused branches. We consider this choice justified because in order to collapse a clade, one must break its branch. The clade resulting from taxon pruning in a restricted validity domain is the ‘heir’ of one or more pre-pruning clade(s), as they differ only with respect to the terminals that have been pruned. This new clade may thus be supported by several successive branches in the original tree, each of which has to be broken. This clade can therefore be considered to be as strong as the strongest of its ‘ancestors’ in the original trees. 2.7. Displaying reliable clades Some clades repeated in the separate analyses can be absent from the tree based on all available data. This has been shown theoretically (see the clade BCD in Barrett et al., 1991, Fig. 1) as well as B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 357 Fig. 4. Maximum likelihood tree obtained by the analysis of the combined matrix of the four nuclear genes (‘total evidence’) under a GTR + I + C model with phyML (Guindon and Gascuel, 2003). Bootstrap proportions are reported for clades over 70%. empirically (Dettaï and Lecointre, 2004, Figs. 4 and 5 therein). This is one of the grounds to conduct both separate and simultaneous analyses (Nixon and Carpenter, 1996). A tree summarizing the clades considered reliable has to be constructed to allow the visualization of the possible discrepancies. To synthesize the results of the reliability analysis, we used a supertree approach derived from the MRP method (Baum and Ragan, 2004): the bipartitions with positive repetition indices from the various third-level validity domains were gathered in a matrix representation and weighted by their repetition indices. This matrix was analyzed under maximum parsimony. 3. Results 3.1. Effect of RNF213 on support Fig. 2 is the tree based on RNF213 sequence data only. The marker allows to recover clades already recorded in previous molecular phylogenies (Dettaï and Lecointre, 2005, 2008, Table 4), namely A, D, E0 , F, G, H, E0 + H, L, M, Q, X, Is, Isc, P (Zeioidei, Gadiformes, Polymixiiformes, Percopsiformes and Lampridiformes, as in Dettaï and Lecointre, 2008, submitted for publication). Clade N (Dettaï and Lecointre, 2005, 2008; Yamanoue et al., 2007; Kawahara et al., 2008; Holcroft and Wiley, 2008) fails to ap- pear. Lophiiforms and Siganus are out of it, though without resolution. Resolution inside N is also very poor. Clade B is the monophyly of Beryciformes sensu lato (Chen et al., 2003; Miya et al., 2005), however that clade is not repeated throughout studies. Clades C and O are not recovered because of incomplete taxonomic samplings, while clades I, J, K are contradicted. Comparing Fig. 3 (combination of Rhodopsin, MLL and IRBP) to Fig. 4 (combination of all four markers), it is not clear whether RNF213 sequence data are able to improve resolution. More investigation is needed to establish whether clade N should also include (as in Fig. 3) Monodactylidae and Lutjanidae (they should according to Yamanoue et al., 2007; Holcroft and Wiley, 2008), Leiognathidae, Cepolidae, Labridae, Scaridae and Moronidae (the last three are closely related in Dettaï and Lecointre, submitted for publication), Centrarchidae, Elassomatidae (as suggested in Dettaï and Lecointre, submitted for publication), Callanthiidae, Priacanthiidae, Caesionidae, Malacanthidae, Datnioididae, and Scatophagidae, Sciaenidae and Haemulidae (as in Chen et al., 2007). The previously described clade N plus the families listed above constitute a working hypothesis that we call here ‘extended N’. That clade is rendered paraphyletic in Fig. 4 (‘total evidence’) and Fig. 5 (supertree based on reliability indices). If those topologies are to be trusted, it could be extended again to contain Kyphosidae, Aplodactylidae, Cheilodactylidae, Sparidae, Champsodontidae and clades X, G and R. 358 B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 Fig. 5. Supertree exhibiting the clades having the highest repetition indices (Li and Lecointre, 2008) in the partial combination and validity domains approach. The tree is the majority-rule consensus of the most parsimonious trees obtained by 10,000 RAS + TBR parsimony analyses by PAUP* (Swofford, 2002) of the matrix representing the clades with positive repetition indices, weighted by their repetition indices. The values above the branches are the percentages of equally parsimonious trees that include the clades. The illustrations come from Fishbase (Froese and Pauly, 2006). In Figs. 3 and 4, clade H is the sister-group of clade E (forming together clade S) while clade H is the sister group of E0 in Fig. 2 (RNF213 data only). This E0 + H clade might be due to the lack of taxa of clade E in the RNF213 dataset. 3.2. New results from RNF213 sequence data The new RNF213 sequence data adds some interesting results, while others come from the addition of new taxa to the previously published samplings. The ability of RNF213 sequence data to get more clades can be assessed through clades absent from Fig. 3 and present in Figs. 2 and 4: Clade Q (Dettaï and Lecointre, 2005, 2008) is recovered (Gobiesociformes, Blennioidei, Atherinomorpha, Mugiloidei, Pomacentridae) with a new member, the Plesiopidae; Family Plesiopidae is in clade C, probably as sister-group to the Mugiloidei; Clade E0 : Mullidae, Callionymidae, Syngnathidae. That clade is not new, already proposed in Dettaï and Lecointre (submitted for publication) and not contradicted by Kawahara et al. (2008) because of poor support within their clade ‘D’ and absence of any mullid or callionymid; Clade R: Howellidae, Lateolabracidae and Epigonidae. It was already present in Smith and Craig (2007); Clade T: Notothenioidei, Trachinidae due to the addition of Echiichthys; Clade Z: Cottoidei, Zoarcoidei, Gasterosteidae, Triglidae, Scorpaenidae, Sebastidae, Synanceiidae, Congiopodidae. That clade is a beginning of structuration within clade X (Dettaï and Lecointre, 2004). Clade S (E + H) because members of E are present in Figs. 3 and 4; Indostomidae is a member of clade F because Indostomus is added (also found by several studies, Miya et al., 2003, 2008); Clade U: Pampus (Stromateidae) sister-group of all other members of H in Figs. 2–4; B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 359 Fig. 5. (continued) Clade V: L + F in Figs. 3 and 4; Clade L0 : Coryphaenidae and Echeneidae nested within the Carangidae. Fig. 5 is the supertree summarizing the reliable clades. When this tree is compared to Fig. 2, it appears that some of the new clades listed above were recovered by RNF213 only. Clade R: Epigonidae, Lateolabracidae and Howellidae form a clade (as in Smith and Craig, 2007); Indostomidae is a member of clade F (as in Miya et al., 2003; Kawahara et al., 2008); Clade Q including the Plesiopidae; Clade T (Notothenioidei, Trachinidae, contradicting the clade K of Dettaï and Lecointre (2004, 2005). These clades are an indication that the new marker has the potential to help to the emergence of some not yet identified reliable clades, while it also has the potential to recover clades previously recorded as reliable, like A, D, Q, H, f1, f2, F, G, Is, Isc, X, L, M. The comparison of Fig. 5 with Fig. 4 is interesting to evaluate whether there are reliable clades that do not appear in the tree based on the simultaneous analysis of all datasets (‘total evidence’). It is indeed the case for the following clades: Clade W: Apogonidae and Gobioidei; Clade M0 : Sciaenidae and Haemulidae; Clade M00 : Centrarchidae, Moronidae and Elassomatidae; This discrepancy has already been described (Dettaï and Lecointre, 2004), and is not entirely surprising as the tree based on the whole data can be perturbed by the usual pitfalls of phylogenetic reconstruction like any other tree. Symmetrically, some clades from the total evidence approach are not found in Fig. 5: Clade E0 (Figs. 2 and 4); Clade U (Figs. 2–4); Clade V (Figs. 2–4); These clades are intuitively more problematic because they are found from different trees based on independent data. Clades U and V are striking examples. They are repeated from independent data (Fig. 2: RNF213 data only, and Fig. 3: all other data) while they are not recovered using the multiple combinations protocol. 4. Discussion 4.1. New names for new reliable clades A number of clades had already been recovered in the previous studies and will not be further discussed (Chen et al., 2000, 2003; Dettaï and Lecointre, 2004, 2005, 2008, submitted for publication): A, C, D, E, F, G, H, J, K, L, N, M, P0 . We will focus here on the new results. In both cases, new names are proposed for some of these clades (Table 4) 360 B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 Clade Y: Plesiopids (roundheads) are the sister-group of the Mugiloidei (grey mullets). This has not been proposed before, and was not found by Smith and Craig (2007), as they had no mugiloid included. The large clade Q contains the Mugiloidei (grey mullets), the Plesiopidae (roundheads), the Atherinomorpha (guppies, pupfishes, silversides, needlefishes), the Pomacentridae (damselfishes), the Blennioidei (blennies) and the Gobiesociformes (clingfishes). The group was present with a more reduced sampling in Chen et al. (2003) and Miya et al. (2005), as there were no cichlid, no pomacentrid and no plesiopid; Dettaï and Lecointre (2005) added a cichlid but no pomacentrid and no plesiopid. Different studies showed that the Cichlidae were close to a group containing the Atherinomorpha (Chen et al., 2003, 2007; Dettaï and Lecointre, 2005; Mabuchi et al., 2007) and not to the other members of the six-family labroidei: Labridae and Scaridae (Dettaï and Lecointre, 2005; Mabuchi et al., 2007; Chen et al., 2007). Among these studies, the best taxonomic sampling is reached by Mabuchi et al. (2007) showing that the Pomacentridae, the Embiotocidae (surfperches) and the Cichlidae are close to each other (their clade ‘B’) and to members of what we call here clade Q, while the Odacidae (cales), the Scaridae (parrotfishes) and the Labridae (wrasses) form a clade (their clade ‘A’) and are members of what we call here the ‘extended clade N0 . These results are clearly corroborated by Chen et al. (2007) from independent nuclear and mitochondrial sequence data. The Labroidei are therefore diphyletic and the specialized ‘labroid’ pharyngeal jaw apparatus evolved twice. Here the cichlids (Haplochromis) have an undetermined position within clade Q, while the Blennioidei are the sister-group of the Gobiesociformes (clade D, Chen et al., 2003). It must be noticed that the family Pseudochromidae (dottybacks) may also be a member of clade Q according to the position of Labracinus in the tree of Mabuchi et al. (2007). This is corroborated by the tree of Smith and Craig (2007) where another pseudochromid, Pseudochromis, lies within a clade corresponding to the present clade Q (Cichlidae, Blennioidei, Atherinomorpha). But gobiesociforms and mugiloids are absent in their dataset and some families missing from ours integrate their equivalent of clade Q: Opisthognathidae (jawfishes), Grammatidae and Pholidichthyidae. An interesting feature emerges from the comparison of all these studies. Clade Q may contain the Atherinomorpha, the Mugiloidei, the Plesiopidae, the Pomacentridae, the Cichlidae, the Embiotocidae, the Blennioidei, the Gobiesociformes, the Pseudochromidae, the Opisthognathidae, the Grammatidae and the Pholidichthyidae. A closer look for possible morphological characters uniting all these taxa yielded one candidate. Mooi (1990) records adhesive chorionic filaments arranged around the micropyle of the demersal egg in grammatids, opisthognathids, pomacentrids, plesiopids and apogonids (the latter is not in Q here but in clade W, see page 21). Such eggs are found in pseudochromids (Mooi, 1993) and in plesiopids sensu lato (i.e. including acanthoclinids Mooi, 1993 and notograptids Gill and Mooi, 1993). Gill and Mooi (1993) also record such demersal eggs with filaments in blennioids (here clade Q) and gobioids (here in clade W), as did Breder and Rosen (1966). Parenti (1993) records these eggs as a synapomorphy of the Atherinomorpha (viviparity in that group being a derived condition). Additionally Smith and Wheeler (2004) mention these eggs in the Cichlidae, and Breder and Rosen (1966) in the Gobiesocidae and the Kurtidae (probably in clade W). These eggs are recorded in 9 of the 12 potential components of clade Q. The Mugiloidei and the Embiotocidae do not have these eggs (Breder and Rosen, 1966), but these conditions may be reversals, as mugiloids are the sister group of plesiopids and embiotocids are grouped with cichlids and pomacentrids. Demersal eggs with filaments may therefore be a synapomorphy of the clade. The presence of this character state also in gobioids, kurtids and apogonids remains to be explained. It could have been gained by convergence, but this needs an in-depth comparison to explore the homology in and between these two groups. Alternatively, demersal eggs with chorionic adhesive filaments could also be a synapomorphy of a clade W + Q, however more resolution is needed to test that hypothesis. Clade W: Apogonidae (cardinalfishes) are closely related to the Gobioidei in our Fig. 5 (as in Smith and Wheeler, 2006), while Apogon is grouped with Kurtus in Smith and Craig (2007) in the absence of gobioids. Kurtus is found to be the sister-group of Apogon and gobies in Smith and Wheeler (2006). Interestingly, horizontal and vertical rows of sensory papillae on the head and body are exclusively shared by Apogonidae, Kurtidae (nurseryfishes), Gobioidei (gobies) and Champsodontidae (crocodile toothfishes) (Johnson, 1993, p. 18). However, here Champsodon fails to cluster with the apogonid and gobioidei representatives. On the basis of anatomical data, Prokofiev (2006) stresses a close relationship between the Apogonidae and the Kurtidae (without mentioning the Gobioidei). Comparison of different studies and Smith and Wheeler (2006) suggest that a clade ‘W’ at least composed of Apogonidae, Kurtidae and Gobioidei is worth being investigated further. Like clade Q, this clade would also be supported by the presence of eggs with chorionic adhesive filaments (see page 20). Apogonids and kurtids were not among the potential sister-groups of the Gobioidei identified by Winterbottom (1993): trachinoids, gobiesocoids, hoplichthyids and other scorpaeniforms. However, apogonids and kurtids were not included in his study. Clade T (notothenioids more closely related to trachinids than to percids) contradicts the clade K of Chen et al. (2003) and Dettaï and Lecointre (2004, 2005) where the perches (Percidae) are the most closely related group to Antarctic fishes (Notothenioidei). Nonetheless, in Chen et al. (2003) as well as in Dettaï and Lecointre (2004, 2005), Trachinus (Weeverfish) was always placed very close to clade K. Interestingly, in Smith and Craig (2007) Bembrops (Percophidae), Acanthistius (Serranidae, Anthiinae) and Niphon (Serranidae, Epinephelinae) are inserted between percids and notothenioids and Trachinus is branched off far away, among serranids. On the contrary, in Smith and Wheeler (2006) trachinids are more closely related to notothenioids than percids, while Bembrops is still the closest to notothenioids. In our summary tree (Fig. 5), Niphon is among serranids and Acanthistius has an undertermined position. Sequence data for the genes analyzed here would be much needed for Bembrops, to test their effects on the relative positions of trachinids and percids and get a clearer idea about the sister-group of notothenioids. Clade Z is providing more precision within clade X: Synanceiidae (stonefishes), Scorpaenidae (scorpionfishes and rockfishes), Congiopodidae (pigfishes) and Sebastidae (thornyheads) constitute the stem-group of clade Isc. Clade Z cannot be identified in most other studies because of insufficient taxonomic sample overlap. In Smith and Craig (2007) the clade is very well represented by 33 terminals however it is not recovered because the Synanceiidae branches outside it and a clade made of the Bembridae (deepwater flatheads), Plectrogeniidae, and their ‘clade E’ (notothenioids, percids, percophids, anthines) is included in it. It is important to note that we have identified clade X and clade Z without taking into account single unstable taxa ‘escaping’ with no determined position. In fact, the problematic four taxa (Acanthistius, Pseudaphritis, Liopropoma, Plectropomus) have sequences for one marker only and have question marks for all the other genes. More data are needed to stabilize their position. Moreover, the pinguipedid Parapercis (grubfishes and sandperches) B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 is nested among serranids in Fig. 5. In Smith and Craig (2007) it is close to other trachinoid families like Ammodytidae (sandlances) and Cheimarrichthyidae (torrentfish), like in our Fig. 2. The position of Parapercis in Fig. 5 must be taken with caution. Indeed, clade G includes Pinguipes in Fig. 5 (along with three formerly ‘trachinoid’ families Ammodytidae, Uranoscopidae (stargazers), Cheimarrichthyidae) and in Fig. 2 the two pinguipedids Pinguipes and Parapercis are both placed in clade G. More sequence data is needed for Parapercis before a conclusion can be drawn on the mono- or polyphyly of the Pinguipedidae. Clade S (H and E) is recovered in Figs. 3–5; it does not appear in other studies because of the lack of overlap between the taxonomic samplings. In Chen et al. (2007), there is a ‘backbone’ of clade E0 + H with Mullus (E0 ) associated to Scomberomorus and Psenopsis (H). The study of Kawahara et al. (2008) dealing with the polyphyly of the Gasterosteiformes from independent sequence datasets using a complete sampling of that order at the family level includes no member of our ‘clade H’. Moreover the position of their ‘clade C’ (containing Macrorhamphosus, Aulostomus and dactylopterids) is poorly supported, leaving the question open. The Gasterosteiformes are polyphyletic, with indostomids (armored sticklebacks) within clade F (with synbranchiformes) and gasterosteids (sticklebacks) closely related to the Zoarcoidei (eelpouts), a result fully confirmed by independent data in Miya et al. (2003) and in Kawahara et al. (2008) with a much larger sampling for gasterosteiform. In Kawahara et al. (2008), the Syngnathoidei are paraphyletic, including dactylopterids (flying gunards). Gasterosteoids are closer to the Zoarcoidei and indostomids closer to symbranchiforms. Interestingly, here, part of the Syngnathoidei (Macrorhamphosus and Aulostomus) are close to the Dactylopteridae (clade E) however other syngnathoids (Aeoliscus, Syngnathus, Hippocampus and Nerophis) never group with them, probably because they have long branches. Though they concluded from comparative anatomy and bone development that indostomids were gasterosteoid gasterosteiforms, Britz and Johnson (2002) mentioned a feature that is shared by indostomids and mastacembelids (though also by most other gasterosteoids): the lack of distal radials in all pterygiophores supporting fin spines at all developmental stages. Clade M0 (Sciaenidae (croakers) and Haemulidae (grunts)) has not been found by molecular studies because of lack of representatives included for these families. However, Smith and Craig (2007) did sample those two families but they do not appear related to each other in their tree. Also, from partially independent sequence data in Chen et al. (2007), haemulids appear close to lutjanids and sparids while sciaenids are closer to drepanids and chaetodontids. The same applies for clade M00 grouping the Centrarchidae (sunfishes), the Moronidae (temperate basses) and the Elassomatidae (pygmy sunfishes). Moreover, that clade contradicts the association of the Moronidae in Dettaï and Lecointre (submitted for publication) with some members of the labroids (i.e. labrids and scarids) and some members of the polyphyletic trachinoids. In Chen et al. (2007), Elassoma is not related to moronids and this family is closer to labrids and scarids. Clade M00 should be evaluated again with more taxa. Clades L0 and L00 are structuring the inside of clade L. Carangids (jacks and pompanos) are placed as the stem group of the Echeneoidea (sensu Johnson, 1993), represented here by Echeneidae (remoras) and Coryphaenidae (dolphinfishes). The Sphyraenidae (barracudas) are the sister-group of carangoids (carangids plus Echeneoidea). Johnson (1984, 1993) defined the Carangoidei as the Carangidae, Echeneidae, Rachycentridae, Nematistiidae and Coryphaenidae. Those clades L0 and L00 have not been found by 361 previous molecular studies because of the lack of representation of these groups. The exception is Smith and Wheeler (2006), who confirm these two clades. Smith and Craig (2007) did find an equivalent of L but did not find any clade compatible with clade L00 as the Sphyraenidae are branched well within L. Clade R: Epigonus, Howella, and Lateolabrax form a clade (already found by Smith and Craig (2007)) suggesting close relationships of Howella, Lateolabracidae (Asian seaperches) and Epigonidae (deepwater cardinalfishes). Interestingly, the study of Smith and Craig (2007) includes other percichthyid genera (namely Bostockia, Gadopsis, Macquaria, Nannoperca), but Howella is not grouped with them but within their equivalent of clade R, suggesting the polyphyly of the Percichthyidae. This would not be surprising as the family is known to be poorly defined (Nelson, 1994). Prokofiev (2007) even erected a new family with three genera (Howellidae) on the basis of several osteological features. Other families like Polyprionidae (wreckfishes), Dinolestidae (long-finned pike), Pentacerotidae (armorheads), Acropomatidae (lanternbellies) appear in Smith and Craig (2007) as more closely related to the clade grouping Howella, Epigonus and Lateolabrax than Howella is to the other Percichthyidae. Sequence data for more markers from all those key taxa would be of interest to confirm the polyphyly of the Percichthyidae. Clade P is interesting. As a large clade located at the base of the acanthomorph tree, it has been difficult to find because of longbranch attractions in molecular studies of acanthomorph phylogeny. Long-branch attractions tend to attract the longest branches towards the outgroups (which have long branches by definition, see for example Dettaï and Lecointre, 2005) and create comb-like tree shapes at the most basal parts of the trees. Clade P groups Polymixiiformes (beardfishes), Percopsiformes (trout-perches), Lampridiformes (oarfishes and opahs), Zeioidei (dories), and Gadiformes (cods). The clade appears in Dettaï and Lecointre (2008) and is only partial in Dettaï and Lecointre (2005). It is contradicted by studies using complete mitochondrial sequence data (Miya et al., 2001, 2003, 2005, 2007) on a single point: the Lampridiformes are attracted to a non-acanthomorph group (either Myctophiformes or Ateleopodiformes). In Miya et al. (2007), RAG1 places Lampridiformes sister to the Acanthopterygii. Our large-scale clade P contains two orders of the former paracanthopterygians (Percopsiformes and Gadiformes) and during the last ten years the polyphyly of the Paracanthopterygii has been demonstrated several times by independent teams and data: the Lophiiformes are members of clade N, the Gobiesociformes members of clade D and the Batrachoidiformes the sister-group of what we call here clade F (Miya et al., 2005). Basal Acanthomorpha: present results corroborate that clade P is the most basal among acanthomorphs sampled here and that ophidiifoms (cusk-eels) are the sister-group of non-P and nonberyciform acanthomorphs (as in Miya et al., 2003, 2005). A number of groups are found in several trees however they are absent from Fig. 5 and not considered to be reliable. They can be used as working hypotheses. Clade U: Pampus (Stromateidae) sister-group of all other members of H in Figs. 2–4; Clade V: Carangimorpha (L) + Anabantiformes (F) found in Figs. 2–4; Extended N: clade N including Monodactylidae (fingerfishes), Lutjanidae (snappers), Leiognathidae (ponyfishes), Cepolidae (bandfishes), Labridae (wrasses), Scaridae (parrotfishes) and Moronidae, Centrarchidae, Elassomatidae, Callanthiidae (groppos), Priacanthiidae (bigeyes), Caesionidae (fusiliers), Scatophagidae (scats), Malacanthidae (tilefishes), Datnioididae 362 B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 (tigerperches), Kyphosidae (sea chubs), Aplodactylidae (marblefishes), Cheilodactylidae (morwongs), Sparidae (porgies), Champsodontidae (crocodile toothfishes), clades X, G, M0 and R. Fig. 5—as a possible bias in the tree from the ‘total evidence’—must therefore be taken with caution. Acknowledgments As discussed above, a clade can be considered reliable when it has been recovered on several independent datasets, and whenever possible by several teams independently. New clades are hypotheses of interrelationships that need to be tested through various sources of data by other teams before being accepted by the community. This is why new clades temporarily received letters (as in Chen et al., 2003; Kawahara et al., 2008; Dettaï and Lecointre, 2005; Dettaï and Lecointre, 2008) suggesting that they were working hypotheses. However, as letters differ from one study to another for the same clades, a need for stabilization emerges. Once the new clades are sufficiently corroborated, it becomes necessary to give them names, for convenience’ sake. In the case of acanthomorphs, the new names were proposed by Johnson and Patterson (1993). Almost none of the molecular studies of large-scale acanthomorph interrelationships (Chen et al., 2000, 2003; Wiley et al., 2000; Miya et al., 2001, 2003; Dettaï and Lecointre, 2004, 2005, 2008; Smith and Wheeler, 2004, 2006) proposed new names. It is striking that, while many clades were recovered several times from independent genes and teams, they still remain unnamed. Table 4 proposes names for the clades that have been repeatedly recovered in the molecular phylogenies of acanthomorphs. All the 311 (Nelson, 2006) acanthomorph families have not yet been included in a single study. However this is not an obstacle and recommendations for names can be made progressively as new families are included. Smith and Craig (2007) added new evidence and summarized results from different studies. They then proposed new and necessary delimitations for serranids, percoids, trachinoids, resurrected epinephelids and niphonids, and created the Moronoidei. We have a single minor point of disagreement with their propositions: they proposed to incorporate the Notothenioidei and the Percophidae into the new Notothenioidea. ‘Notothenioidei’ has the suborder termination; while ‘Notothenioidea’ has the super family termination: the second cannot contain the first. Therefore, the name Notothenioidea should be replaced by the name Notothenioidi. The status of our Notothenioidiformes with regard to Smith and Craig’s Percoidei will be clarified once sequences of Niphon, Acanthistius and Bembrops will be accessible for the present four molecular markers. 4.2. Supertrees and reliability In Li and Lecointre (2008), since all trees were built on the same set of taxa, the repetition indices could easily be mapped on the summary tree. Here, the MRP supertree plays the role of a summary tree and is obtained from several partially-overlapping third-level validity domains. Since the repetition indices that were used to weight the clades are only valid in their restricted validity domains, no repetition index is displayed on the supertree. MRP is known to have biases. Even if the bipartitions were weighted according to their repetition indices, the reliability of clades shown in the summary tree holds if the supertree method used is itself accurate. Moreover, our conclusions could be affected by some taxa with undetermined position because the method (supertree based on clades weighted according to Li and Lecointre’s repetition index) does not seem to handle well taxa present in only one elementary dataset (e.g. as a result Acanthistius, Plectropomus and Liopropoma do not join serranids, Aeoliscus does not group with macrorhamphosids, Centropomus is not close to Lates, Balistes fails to join the Tetraodontiformes, Pseudaphritis fails to join notothenioids, Encheliophis is not close to Echiodon). The interpretation given to clades present in the ‘total evidence’ tree (Fig. 4) and not in This work was supported by the ‘Consortium National de Recherche en Génomique’, and the ‘Service de Systématique Moléculaire’ of the Muséum National d’Histoire Naturelle (IFR 101). It is part of the agreement number 2005/67 between the Genoscope and the Muséum National d’Histoire Naturelle on the project ‘Macrophylogeny of life’ directed by Guillaume Lecointre. Part of this work was carried out by using the resources of the Computational Biology Service Unit from the Muséum National d’Histoire Naturelle (MNHN) which was partially funded by Saint Gobain. Thanks to Damien Hinsinger for some of the new MLL sequences. Thanks to Bruno Chanet and Laure Corbari for help and advice. The name ‘Stiassnyiformes’ is proposed for clade Q, refering to the title of the paper of Stiassny (1993). Figures were prepared using TikZ (http://sourceforge.net/projects/pgf/), TreeGraph (Müller and Müller, 2004), Inkscape (http://www.inkscape.org/) and Ipe (http://tclab.kaist.ac.kr/ipe/). References Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W., Lipman, D.J., 1997. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25 (17), 3389–3402. Barrett, M., Donoghue, M., Sober, E., 1991. Against consensus. Syst. Zool. 40 (4), 486–493. Baum, B., Ragan, M., 2004. The MRP method. In: Bininda-Edmonds, O. (Ed.), Phylogenetic supertrees: combining information to reveal the tree of life. Kluwer Academic, Dordrecht, The Netherlands, pp. 17–34. Breder, C.M., Rosen, D.E., 1966. Modes of reproduction in fishes. The Natural History Press, New York. Britz, R., Johnson, D., 2002. ‘‘paradox lost”: skeletal ontogeny of Indostomus paradoxus, and its significance for the phylogenetic relationships of Indostomidae (Teleostei, Gasterosteiformes). Am. Mus. Novit. (3383), 1–43. http://hdl.handle.net/2246/2872. Bull, J., Huelsenbeck, J., Cunningham, C., Swofford, D., Waddell, P., 1993. Partitioning and combining data in phylogenetic analysis. Syst. Biol. 42 (3), 384–397. Chen, W.-J., 2001. La répétitivité des clades comme critère de fiabilité: application à la phylogénie des Acanthomorpha (Teleostei) et des Notothenioidei (acanthomorphes antarctiques). Ph.D. thesis, Université Paris VI Pierre et Marie Curie. Chen, W.-J., Bonillo, C., Lecointre, G., 2000. Taxonomic congruence as a tool to discover new clades in the acanthomorph (Teleostei) radiation. In: Program Book and Abstracts, 80th Annual Meeting ASIH, La Paz, México, June 14-20, 2000. American Society of Ichthyologists and Herpetologists, American Society of Ichthyologists and Herpetologists, p. 369. Chen, W.-J., Bonillo, C., Lecointre, G., 2003. Repeatability of clades as a criterion of reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei) with larger number of taxa. Mol. Phylogenet. Evol. 26, 262–288. Chen, W.-J., Ruiz-Carus, R., Ortí, G., 2007. Relationships among four genera of mojarras (Teleostei: Perciformes: Gerreidae) from the western Atlantic and their tentative placement among percomorph fishes. J. Fish Biol. 70, 202–218. http://dx.doi.org/10.1111/j.1095-8649.2007.01395.x. Dettaï, A., Lecointre, G., 2004. In search of nothothenioid (Teleostei) relatives. Antarct. Sci. 16 (1), 71–85. URL http://dx.doi.org/10.1017/S0954102004. Dettaï, A., Lecointre, G., 2005. Further support for the clades obtained by multiple molecular phylogenies in the acanthomorph bush. C.R. Biol. 328, 674–689. Dettaï, A., Lecointre, G., 2008. New insights into the organization and evolution of vertebrate IRBP genes and utility of IRBP gene sequences for the phylogenetic study of the Acanthomorpha (Actinopterygii: Teleostei). Mol. Phylogenet. Evol. 48 (1), 258–269. URL http://dx.doi.org/10.1016/j.ympev.2008.04.003. Dettaï, A., Lecointre, G., submitted for publication. Clade reliability in spiny teleosts. Foster, P.G., 2004. Modeling compositional heterogeneity. Syst. Biol. 53 (3), 485– 495. URL http://dx.doi.org/10.1080/10635150490445779. Froese, R., Pauly, D., 2006. Fishbase. World Wide Web electronic publication. URL www.fishbase.org, version (06/2006). URL www.fishbase.org. Gill, A.C., Mooi, R.D., 1993. Monophyly of the Grammatidae and of the Notograptidae, with evidence for their phylogenetic positions among perciforms. B. Mar. Sci. 52 (1), 327–350. Grande, L., 1994. Repeating patterns in nature, predictability, and ‘‘impact” in science. In: Grande, L., Rieppel, O. (Eds.), Interpreting the hierarchy of nature, 1st ed. Academic Press, New York, pp. 61–84. Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Syst. Biol. 52 (5), 696–704. URL http://dx.doi.org/10.1080/10635150390235520. B. Li et al. / Molecular Phylogenetics and Evolution 50 (2009) 345–363 Hall, T., 2001. Bioedit version 5.0.6. North Carolina State University, Department of Microbiology. Holcroft, N.I., Wiley, E.O., 2008. Acanthuroid relationships revisited: a new nuclear gene-based analysis that incorporates tetraodontiform representatives. Ichthyol. Res. Online, 1–10. URL http://dx.doi.org/10.1007/s10228-007-0026-x. Hubbard, T., Andrews, D., Caccamo, M., Cameron, G., Chen, Y., Clamp, M., Clarke, L., Coates, G., Cox, T., Cunningham, F., Curwen, V., Cutts, T., Down, T., Durbin, R., Fernandez-Suarez, X.M., Gilbert, J., Hammond, M., Herrero, J., Hotz, H., Howe, K., Iyer, V., Jekosch, K., Kahari, A., Kasprzyk, A., Keefe, D., Keenan, S., Kokocinsci, F., London, D., Longden, I., McVicker, G., Melsopp, C., Meidl, P., Potter, S., Proctor, G., Rae, M., Rios, D., Schuster, M., Searle, S., Severin, J., Slater, G., Smedley, D., Smith, J., Spooner, W., Stabenau, A., Stalker, J., Storey, R., Trevanion, S., Ureta-Vidal, A., Vogel, J., White, S., Woodwark, C., Birney, E., 2005. Ensembl 2005. Nucleic Acids Res. 33, 447–453. URL http://dx.doi.org/10.1093/nar/gki138. Johnson, D., 1984. Percoidei: development and relationships. In: Richards, W.J., Cohen, D.M., Fahay, M.P., Kendall, A.W., Jr., Richardson, S.L. (Eds.), Ontogeny and systematics of fishes (based on an international symposium dedicated to the memory of Elbert Halvor Ahlstrom). Allen Press, Lawrence, Kansas, pp. 464– 498. Johnson, D., 1993. Percomorph phylogeny: progress and problems. B. Mar. Sci. 52 (1), 3–28. Johnson, D., Patterson, C., 1993. Percomorph phylogeny: a survey of acanthomorphs and a new proposal. B. Mar. Sci. 52 (1), 554–626. Kawahara, R., Miya, M., Mabuchi, K., Lavoué, S., Inoue, J., Satoh, T., Kawaguchi, A., Nishida, M., 2008. Interrelationships of the 11 gasterosteiform families (sticklebacks, pipefishes, and their relatives): A new perspective based on whole mitogenomes sequences from 75 higher teleosts. Mol. Phylogenet. Evol. 46, 224–236. URL http://dx.doi.org/10.1016/j.ympev.2007.07.009. Lecointre, G., Deleporte, P., 2005. Total evidence requires exclusion of phylogenetically misleading data. Zool. Scr. 34 (1), 101–117. Li, B., Lecointre, G., 2008. Formalizing reliability in the taxonomic congruence approach. Article accepted by Zoologica Scripta. URL http://dx.doi.org/10.1111/ j.1463-6409.2008.00361.x. Li, C., Lu, G., Orti, G., 2008. Optimal data partitioning and a test case for ray-finned fishes (Actinopterygii) based on ten nuclear loci. Syst. Biol. 57 (4), 519–539. URL http://dx.doi.org/10.1080/10635150802206883. Li, C., Orti, G., Zhang, G., Lu, G., 2007. A practical approach to phylogenomics: the phylogeny of ray-finned fish (Actinopterygii) as a case study. BMC Evol. Biol. 7 (44), 1–11. URL http://dx.doi.org/10.1186/1471-2148-7-44. Mabuchi, K., Miya, M., Azuma, Y., Nishida, M., 2007. Independent evolution of the specialized pharyngeal jaw apparatus in cichlid and labrid fishes. BMC Evolutionary Biology 7 (10), 1–12. URL http://dx.doi.org/10.1186/1471-21487-10. Mickevich, M., 1978. Taxonomic congruence. Syst. Zool. 27, 143–158. Miya, M., Holcroft, N.I., Satoh, T.P., Yamaguchi, M., Nishida, M., Wiley, E.O., 2007. Mitochondrial genome and a nuclear gene indicate a novel phylogenetic position of deep-sea tube-eye fish (Stylephoridae). Ichthyol. Res. 54, 323–332. URL http://dx.doi.org/10.1007/s10228-007-0408-0. Miya, M., Kawaguchi, A., Nishida, M., 2001. Mitogenomic exploration of higher teleostean phylogenies: A case study for moderate-scale evolutionary genomics with 38 newly determined complete mitochondrial DNA sequences. Mol. Biol. Evol. 18 (11), 1993–2009. Miya, M., Satoh, T., Nishida, M., 2005. The phylogenetic position of toadfishes (order Batrachoidiformes) in the higher ray-finned fish as inferred from partitioned Bayesian analysis of 102 whole mitochondrial genome sequences. Biol. J. Linn. Soc. 85, 289–306. Miya, M., Takeshima, H., Endo, H., Ishiguro, N., Inoue, J., Mukai, T., Satoh, T., Yamaguchi, M., Kawaguchi, A., Mabuchi, K., Shirai, S., Nishida, M., 2003. Major patterns of higher teleostean phylogenies: a new perspective based on 100 complete mitochondrial DNA sequences. Mol. Phylogenet. Evol. 26, 121– 138. Miyamoto, M., Fitch, W., 1995. Testing species phylogenies and phylogenetic methods with congruence. Syst. Biol. 44 (1), 64–75. Mooi, R.D., 1990. Egg surface morphology of pseudochromoids (Perciformes: Percoidei), with comments on its phylogenetic implications. Copeia (2), 455– 475. 363 Mooi, R.D., 1993. Phylogeny of the Plesiopidae (Pisces: Perciformes), with evidence for the inclusion of the Acanthoclinidae. B. Mar. Sci. 52 (1), 284–326. Müller, J., Müller, K., 2004. TreeGraph: automated drawing of complex tree figures using an extensible tree description format. Mol. Ecol. Notes 4, 786–788. Nelson, G.J., 1979. Cladistic analysis and synthesis: principles and definitions, with a historical note on Adanson’s Familles des plantes (1763-1764). Syst. Zool. 28, 1– 21. Nelson, G.J., 1989. Phylogeny of major fish groups. In: Jörnvall, H., Fernholm, B., Bremer, K. (Eds.), The hierarchy of life: molecules and morphology in phylogenetic analysis. Nobel Foundation, Excerpta Medica, Amsterdam, pp. 325–336. Nelson, J., 1994. Fishes of the World, third ed. John Wiley and Sons, Inc., Hoboken, New Jersey. Nelson, J., 2006. Fishes of the World, fourth ed. John Wiley and Sons, Inc., Hoboken, New Jersey. Nixon, K.C., Carpenter, J.M., 1996. On simultaneous analysis. Cladistics 12 (3), 221– 241. URL http://dx.doi.org/10.1111/j.1096-0031.1996.tb00010.x. Page, R., Holmes, E., 1998. Molecular Evolution. Blackwell Science, Oxford. Parenti, L.R., 1993. Relationships of the atherinomorph fishes (Teleostei). B. Mar. Sci. 52 (1), 170–196. Philippe, H., Douzery, E., 1994. The pitfalls of molecular phylogeny based on four species, as illustrated by the Cetacea/Artiodactyla relationships. J. Mammal. Evol. 2 (2), 133–152. Prokofiev, A.M., 2006. A new genus of cardinalfishes (Perciformes: Apogonidae) from the south China sea, with a discussion of the relationships between the families Apogonidae and Kurtidae. J. Ichthyol. 46 (4), 279–291. URL http:// dx.doi.org/10.1134/S0032945206040011. Prokofiev, A.M., 2007. The osteology of Bathysphyraenops symplex and the diagnosis of the Howellidae (Perciformes: Percoidei) family. Journal of Ichthyology 47 (8), 566–578. URL http://dx.doi.org/10.1134/S0032945207080036. Rambaut, A., 2002. Se-Al, Sequence Alignment Editor, version 2.0a11. Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3PS, UK. Rieppel, O., 2004. The language of systematics, and the philosophy of ‘total evidence’. Syst. Biodivers. 2 (1), 9–19. Smith, L., Craig, M., 2007. Casting the percomorph net widely: the importance of broad taxonomic sampling in the search for the placement of serranid and percid fishes. Copeia (1), 35–55. Smith, L., Wheeler, W., 2004. Polyphyly of the mail-cheeked fishes (Teleostei: Scorpaeniformes): evidence from mitochondrial and nuclear sequence data. Mol. Phylogenet. Evol. 32, 627–646. Smith, L., Wheeler, W., 2006. Venom evolution widespread in fishes: a phylogenetic road map for the bioprospecting of piscine venoms. J. Hered. 97 (3), 206–217. URL http://dx.doi.org/10.1093/jhered/esj034. Stiassny, M., 1993. What are grey mullets? B. Mar. Sci. 52 (1), 197–219. Stiassny, M., Moore, J., 1992. A review of the pelvic girdle of acanthomorph fishes, with comments on hypotheses of acanthomorph intrarelationships. Zool. J. Linn. Soc.-Lond. 104, 209–242. Stiassny, M.L.J., Wiley, E.O., Johnson, G.D., de Carvalho, M.R., 2004. Gnathostome fishes. In: Cracraft, J., Donoghue, M.J. (Eds.), Assembling the tree of life. Oxford University Press, New York. Swofford, D., 2002. PAUP. Phylogenetic analysis using parsimony ( and other methods), version 4.0b10. Sinauer Associates, Sunderland, Massachusetts. Wiens, J., Reeder, T., 1995. Combining data sets with different numbers of taxa for phylogenetic analysis. Syst. Biol. 44 (4), 548–558. URL http://dx.doi.org/ 10.2307/2413660. Wiley, E.O., Johnson, G.D., Dimmick, W.W., 2000. The interrelationships of acanthomorph fishes: a total evidence approach using molecular and morphological data. Biochem. Syst. Ecol. 28, 319–350. Winnepenninckx, B., Backeljau, T., Dewachter, R., 1993. Extraction of highmolecular-weight DNA from mollusks. Trends Genet. 9 (12), 407. Winterbottom, R., 1993. Search for the gobioid sister group (Actinopterygii: Percomorpha). B. Mar. Sci. 52 (1), 395–414. Yamanoue, Y., Miya, M., Matsuura, K., Yagishita, N., Mabuchi, K., Sakai, H., Katoh, M., Nishida, M., 2007. Phylogenetic position of tetraodontiform fishes within the higher teleosts: Bayesian inferences based on 44 whole mitochondrial genome sequences. Mol. Phylogenet. Evol. 45, 89–101.

RELATED PAPERS

RELATED TOPICS

Log In

RNF213, a new nuclear marker for acanthomorph phylogeny

RNF213, a new nuclear marker for acanthomorph phylogeny

Related Papers

RELATED PAPERS

RELATED TOPICS